Product Details

SNP ID: rs141882731
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:35087970 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GATAACCTTGACATCTTGAAATGAA[A/T]CAGGATCTTGTCCATGGATTTTCAT
Phenotype: MIM: 615902
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: FAM177A1 PubMed Links

Gene Details

Gene: FAM177A1
Gene Name: family with sequence similarity 177 member A1

There are no transcripts associated with this gene.

Gene: LOC101927178
Gene Name: uncharacterized LOC101927178

There are no transcripts associated with this gene.

Gene: PPP2R3C
Gene Name: protein phosphatase 2 regulatory subunit B''gamma

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001305155.1	1618	Missense Mutation	GAT,GTT	D275V	NP_001292084.1
NM_001305156.1	1618	Missense Mutation	GAT,GTT	D275V	NP_001292085.1
NM_017917.3	1618	Missense Mutation	GAT,GTT	D385V	NP_060387.2
XM_005267782.3	1618	Missense Mutation	GAT,GTT	D385V	XP_005267839.1
XM_017021388.1	1618	Missense Mutation	GAT,GTT	D339V	XP_016876877.1
XM_017021389.1	1618	Missense Mutation	GAT,GTT	D333V	XP_016876878.1

View Full Product Details