Product Details

SNP ID

rs143954376

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.14:21030597 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CTAGCTGACCATGGCATCAGAGGCA[A/G]AAAAAACATTCCATCGGTTTGCTGC

Phenotype

MIM: 605272 MIM: 616956

Polymorphism

A/G, Transition substitution

Allele Nomenclature

Literature Links

MIR6717 PubMed Links

Gene Details

Gene

MIR6717

Gene Name

microRNA 6717

There are no transcripts associated with this gene.

Gene

NDRG2

Gene Name

NDRG family member 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001282211.1	140	Intron			NP_001269140.1
NM_001282212.1	140	Intron			NP_001269141.1
NM_001282213.1	140	Intron			NP_001269142.1
NM_001282214.1	140	Intron			NP_001269143.1
NM_001282215.1	140	Intron			NP_001269144.1
NM_001282216.1	140	Intron			NP_001269145.1
NM_001320329.1	140	Intron			NP_001307258.1
NM_016250.2	140	Intron			NP_057334.1
NM_201535.1	140	Intron			NP_963293.1
NM_201536.1	140	Intron			NP_963294.1
NM_201537.1	140	Intron			NP_963831.1
NM_201538.1	140	Intron			NP_963832.1
NM_201539.1	140	Intron			NP_963833.1
NM_201540.1	140	Intron			NP_963834.1
NM_201541.1	140	Intron			NP_963835.1
XM_011536996.2	140	Intron			XP_011535298.1
XM_011536997.1	140	Intron			XP_011535299.1
XM_011536998.1	140	Intron			XP_011535300.1
XM_011536999.1	140	Intron			XP_011535301.1
XM_011537001.1	140	Intron			XP_011535303.1
XM_011537002.1	140	Intron			XP_011535304.1
XM_017021480.1	140	Intron			XP_016876969.1
XM_017021481.1	140	Intron			XP_016876970.1
XM_017021482.1	140	Intron			XP_016876971.1
XM_017021483.1	140	Intron			XP_016876972.1
XM_017021484.1	140	Intron			XP_016876973.1
XM_017021485.1	140	Intron			XP_016876974.1
XM_017021486.1	140	Intron			XP_016876975.1
XM_017021487.1	140	Intron			XP_016876976.1
XM_017021488.1	140	Intron			XP_016876977.1
XM_017021489.1	140	Intron			XP_016876978.1
XM_017021490.1	140	Intron			XP_016876979.1
XM_017021491.1	140	Intron			XP_016876980.1
XM_017021492.1	140	Intron			XP_016876981.1
XM_017021493.1	140	Intron			XP_016876982.1
XM_017021494.1	140	Intron			XP_016876983.1
XM_017021495.1	140	Intron			XP_016876984.1
XM_017021496.1	140	Intron			XP_016876985.1
XM_017021497.1	140	Intron			XP_016876986.1

Gene

RNASE13

Gene Name

ribonuclease A family member 13 (inactive)

There are no transcripts associated with this gene.

Gene

TPPP2

Gene Name

tubulin polymerization promoting protein family member 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_173846.4	140	Missense Mutation	AAA,GAA	K6E	NP_776245.2
XM_005267324.4	140	Missense Mutation	AAA,GAA	K6E	XP_005267381.1
XM_011536416.1	140	Missense Mutation	AAA,GAA	K6E	XP_011534718.1
XM_011536417.2	140	Missense Mutation	AAA,GAA	K6E	XP_011534719.1
XM_011536418.1	140	Missense Mutation	AAA,GAA	K6E	XP_011534720.1
XM_011536420.2	140	Missense Mutation	AAA,GAA	K6E	XP_011534722.1
XM_017020966.1	140	Missense Mutation	AAA,GAA	K6E	XP_016876455.1

View Full Product Details