Product Details

SNP ID: rs145494283
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:24206625 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGGTGGTGATGTCCTTGAATGGAT[A/C]CAGCGCTACGGGGCCTGCTCTGAGC
Phenotype: MIM: 610051 MIM: 610711
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CHMP4A PubMed Links

Gene Details

Gene: CHMP4A
Gene Name: charged multivesicular body protein 4A

There are no transcripts associated with this gene.

Gene: MDP1
Gene Name: magnesium dependent phosphatase 1

There are no transcripts associated with this gene.

Gene: NEDD8-MDP1
Gene Name: NEDD8-MDP1 readthrough

There are no transcripts associated with this gene.

Gene: TSSK4
Gene Name: testis specific serine kinase 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001184739.1	546	Silent Mutation	ATA,ATC	I114I	NP_001171668.1
NM_001308067.1	546	Silent Mutation	ATA,ATC	I38I	NP_001294996.1
NM_174944.3	546	Silent Mutation	ATA,ATC	I114I	NP_777604.2
XM_011536663.2	546	Silent Mutation	ATA,ATC	I38I	XP_011534965.1
XM_017021226.1	546	Silent Mutation	ATA,ATC	I114I	XP_016876715.1

View Full Product Details