Product Details

SNP ID: rs146619348
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:60975853 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACTGGTCCTTGGAGGAAGTCTTTCC[C/T]ATCCAAGTTGAAGACTTTCACCTTT
Phenotype: MIM: 602659 MIM: 616518 MIM: 611023
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MNAT1 PubMed Links

Gene Details

Gene: MNAT1
Gene Name: MNAT1, CDK activating kinase assembly factor

There are no transcripts associated with this gene.

Gene: SLC38A6
Gene Name: solute carrier family 38 member 6

There are no transcripts associated with this gene.

Gene: TRMT5
Gene Name: tRNA methyltransferase 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_020810.3	1263	Missense Mutation	AGG,GGG	R356G	NP_065861.3
XM_005267916.3	1263	Missense Mutation	AGG,GGG	R384G	XP_005267973.2
XM_011537017.2	1263	Missense Mutation	AGG,GGG	R383G	XP_011535319.1

View Full Product Details