Product Details

SNP ID: rs148919542
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:24311579 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCGGGCAGGTCCCCGTTTCCTCAC[A/G]CGGCTCTTCGAAGGCTCTGGGGAGG
Phenotype: MIM: 600292 MIM: 604441 MIM: 601531 MIM: 605773
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ADCY4 PubMed Links

Gene Details

Gene: ADCY4
Gene Name: adenylate cyclase 4

There are no transcripts associated with this gene.

Gene: CIDEB
Gene Name: cell death-inducing DFFA-like effector b

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318807.1	81	Intron			NP_001305736.1
NM_014430.2	81	Intron			NP_055245.2
XM_011536659.2	81	Intron			XP_011534961.1
XM_017021221.1	81	Intron			XP_016876710.1

Gene: LTB4R
Gene Name: leukotriene B4 receptor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001143919.2	81	UTR 5			NP_001137391.1
NM_181657.3	81	Intron			NP_858043.1

Gene: LTB4R2
Gene Name: leukotriene B4 receptor 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001164692.2	81	Silent Mutation	ACA,ACG	T305T	NP_001158164.1
NM_019839.4	81	Silent Mutation	ACA,ACG	T305T	NP_062813.2

Gene: NOP9
Gene Name: NOP9 nucleolar protein

There are no transcripts associated with this gene.

View Full Product Details