Product Details

SNP ID: rs141243867
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.15:83112875 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGCTCGTGTCCTCGTCAAAAGAAA[A/G]CCACCCCGGGACCCACTGTTCTATG
Phenotype: MIM: 616643 MIM: 606562
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: HDGFRP3 PubMed Links
Additional Information: For this assay, SNP(s) [rs1989] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016073.3	3613	Intron			NP_057157.1
XM_006720554.3	3613	UTR 3			XP_006720617.1

There are no transcripts associated with this gene.

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001144903.1	3613	Silent Mutation	AAA,AAG	K57K	NP_001138375.1
NM_023003.3	3613	Silent Mutation	AAA,AAG	K57K	NP_075379.2
XM_011521679.2	3613	Silent Mutation	AAA,AAG	K57K	XP_011519981.1
XM_011521680.2	3613	Silent Mutation	AAA,AAG	K57K	XP_011519982.1
XM_017022320.1	3613	Silent Mutation	AAA,AAG	K57K	XP_016877809.1
XM_017022321.1	3613	Silent Mutation	AAA,AAG	K57K	XP_016877810.1
XM_017022322.1	3613	Silent Mutation	AAA,AAG	K57K	XP_016877811.1
XM_017022323.1	3613	UTR 5			XP_016877812.1
XM_017022324.1	3613	UTR 5			XP_016877813.1
XM_017022325.1	3613	UTR 5			XP_016877814.1
XM_017022326.1	3613	UTR 5			XP_016877815.1
XM_017022327.1	3613	UTR 5			XP_016877816.1
XM_017022328.1	3613	Silent Mutation	AAA,AAG	K57K	XP_016877817.1
XM_017022329.1	3613	Silent Mutation	AAA,AAG	K57K	XP_016877818.1
XM_017022330.1	3613	Silent Mutation	AAA,AAG	K57K	XP_016877819.1
XM_017022331.1	3613	Silent Mutation	AAA,AAG	K57K	XP_016877820.1