Product Details

SNP ID
rs143562803
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.15:67261283 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TTTTATACCTATAGATCCATGAAGA[C/T]CTTTATCAGTTAAAGGAGAAATTAA
Phenotype
MIM: 614888 MIM: 612523
Polymorphism
C/T, Transition substitution
Allele Nomenclature
Literature Links
AAGAB PubMed Links

Gene Details

Gene
AAGAB
Gene Name
alpha- and gamma-adaptin binding protein
There are no transcripts associated with this gene.

Gene
IQCH
Gene Name
IQ motif containing H
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001031715.2 183 Silent Mutation GAC,GAT D21D NP_001026885.1
NM_001284347.1 183 UTR 5 NP_001271276.1
NM_001284348.1 183 UTR 5 NP_001271277.1
NM_001284349.1 183 UTR 5 NP_001271278.1
NM_001322470.1 183 UTR 5 NP_001309399.1
NM_001322471.1 183 UTR 5 NP_001309400.1
NM_001322472.1 183 UTR 5 NP_001309401.1
NM_001322473.1 183 UTR 5 NP_001309402.1
NM_001322474.1 183 UTR 5 NP_001309403.1
NM_001322475.1 183 UTR 5 NP_001309404.1
NM_022784.2 183 Silent Mutation GAC,GAT D21D NP_073621.2
XM_011521907.2 183 Silent Mutation GAC,GAT D21D XP_011520209.1
XM_011521908.2 183 Silent Mutation GAC,GAT D21D XP_011520210.1
XM_011521911.2 183 Silent Mutation GAC,GAT D21D XP_011520213.1
XM_011521912.2 183 Silent Mutation GAC,GAT D21D XP_011520214.1
XM_011521913.2 183 Silent Mutation GAC,GAT D21D XP_011520215.1
XM_011521914.2 183 Intron XP_011520216.1
XM_011521915.2 183 Silent Mutation GAC,GAT D21D XP_011520217.1
XM_011521916.2 183 Intron XP_011520218.1
XM_011521917.2 183 UTR 5 XP_011520219.1
XM_011521918.2 183 UTR 5 XP_011520220.1
XM_011521922.2 183 Silent Mutation GAC,GAT D21D XP_011520224.1
XM_011521923.2 183 Silent Mutation GAC,GAT D21D XP_011520225.1
XM_017022491.1 183 Silent Mutation GAC,GAT D21D XP_016877980.1
XM_017022492.1 183 Silent Mutation GAC,GAT D21D XP_016877981.1
XM_017022493.1 183 Silent Mutation GAC,GAT D21D XP_016877982.1
XM_017022494.1 183 Silent Mutation GAC,GAT D21D XP_016877983.1
XM_017022495.1 183 Silent Mutation GAC,GAT D21D XP_016877984.1
XM_017022496.1 183 Silent Mutation GAC,GAT D21D XP_016877985.1
XM_017022497.1 183 Silent Mutation GAC,GAT D21D XP_016877986.1
XM_017022498.1 183 Silent Mutation GAC,GAT D21D XP_016877987.1
XM_017022499.1 183 Silent Mutation GAC,GAT D21D XP_016877988.1
XM_017022500.1 183 UTR 5 XP_016877989.1
XM_017022501.1 183 UTR 5 XP_016877990.1
XM_017022502.1 183 UTR 5 XP_016877991.1
XM_017022503.1 183 UTR 5 XP_016877992.1
XM_017022504.1 183 UTR 5 XP_016877993.1

View Full Product Details