Product Details
- SNP ID
-
rs147272988
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.15:69417450 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TGTTGCATAGAAGTGATCAATAATA[A/C]AACTGTTCAGCTTCATACTCCTGAG
- Phenotype
-
MIM: 605064
MIM: 607781
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
KIF23
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs61751119] are located under a probe and SNP(s) [rs3759826] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- KIF23
- Gene Name
- kinesin family member 23
- Gene
- LOC145694
- Gene Name
- uncharacterized LOC145694
There are no transcripts associated with this gene.
- Gene
- PAQR5
- Gene Name
- progestin and adipoQ receptor family member 5
There are no transcripts associated with this gene.
View Full Product Details