Product Details

SNP ID: rs150841154
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:66490570 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTGCAGGTTGGCTCTGCTCCACCAT[C/T]GGCCTTAACCAGCCCAGCACACCAA
Phenotype: MIM: 176872 MIM: 180479 MIM: 605979
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MAP2K1 PubMed Links

Gene Details

Gene: MAP2K1
Gene Name: mitogen-activated protein kinase kinase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002755.3	1485	Intron			NP_002746.1
XM_011521783.2	1485	Intron			XP_011520085.1
XM_017022411.1	1485	Silent Mutation	ATC,ATT	I353I	XP_016877900.1
XM_017022412.1	1485	Silent Mutation	ATC,ATT	I331I	XP_016877901.1
XM_017022413.1	1485	Silent Mutation	ATC,ATT	I203I	XP_016877902.1

Gene: MIR4512
Gene Name: microRNA 4512

There are no transcripts associated with this gene.

Gene: RPL4
Gene Name: ribosomal protein L4

There are no transcripts associated with this gene.

Gene: SNAPC5
Gene Name: small nuclear RNA activating complex polypeptide 5

There are no transcripts associated with this gene.

View Full Product Details