Product Details

SNP ID: rs137942866
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:29813411 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AACCAGAAGTGAGCAAAGAGGCCAC[G/T]GCAGACCAGGGGTCCAGGCTGGAGT
Phenotype: MIM: 603213 MIM: 600999 MIM: 605088 MIM: 612033 MIM: 614386
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: KIF22 PubMed Links

Gene Details

Gene: KIF22
Gene Name: kinesin family member 22

There are no transcripts associated with this gene.

Gene: MAZ
Gene Name: MYC associated zinc finger protein

There are no transcripts associated with this gene.

Gene: MVP
Gene Name: major vault protein

There are no transcripts associated with this gene.

Gene: PAGR1
Gene Name: PAXIP1 associated glutamate rich protein 1

There are no transcripts associated with this gene.

Gene: PRRT2
Gene Name: proline rich transmembrane protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256442.1	653	Silent Mutation	ACG,ACT	T119T	NP_001243371.1
NM_001256443.1	653	Silent Mutation	ACG,ACT	T119T	NP_001243372.1
NM_145239.2	653	Silent Mutation	ACG,ACT	T119T	NP_660282.2
XM_011545715.2	653	Silent Mutation	ACG,ACT	T119T	XP_011544017.1
XM_011545716.2	653	Silent Mutation	ACG,ACT	T119T	XP_011544018.1
XM_017022887.1	653	Silent Mutation	ACG,ACT	T119T	XP_016878376.1
XM_017022888.1	653	Silent Mutation	ACG,ACT	T119T	XP_016878377.1
XM_017022889.1	653	Silent Mutation	ACG,ACT	T119T	XP_016878378.1

View Full Product Details