Product Details

SNP ID: rs139081750
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:4260123 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGTGTCCAGATTTTGCCGGGATGT[C/G]GAAACAGAGTTGATGACCGAGGAGG
Phenotype: MIM: 600743
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: LINC01569 PubMed Links

Gene Details

Gene: LINC01569
Gene Name: long intergenic non-protein coding RNA 1569

There are no transcripts associated with this gene.

Gene: LOC105371063
Gene Name: putative uncharacterized protein encoded by LINC00596

There are no transcripts associated with this gene.

Gene: TFAP4
Gene Name: transcription factor AP-4 (activating enhancer binding protein 4)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003223.2	1179	Silent Mutation	TCC,TCG	S263S	NP_003214.1
XM_011522633.2	1179	Silent Mutation	TCC,TCG	S250S	XP_011520935.1
XM_011522635.2	1179	Silent Mutation	TCC,TCG	S203S	XP_011520937.1

View Full Product Details