Product Details

SNP ID: rs140080780
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:1980021 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTGAGGGGTGCCGCAGCAGCACGT[A/C]CAGGCTCTCCTGGGCCTGCGCCTGA
Phenotype: MIM: 600924 MIM: 611256 MIM: 603927 MIM: 605915
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: GFER PubMed Links

Gene Details

Gene: GFER
Gene Name: growth factor, augmenter of liver regeneration

There are no transcripts associated with this gene.

Gene: NOXO1
Gene Name: NADPH oxidase organizer 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267721.1	944	Missense Mutation	GAC,TAC	D192Y	NP_001254650.1
NM_144603.3	944	Missense Mutation	GAC,TAC	D187Y	NP_653204.1
NM_172167.2	944	Missense Mutation	GAC,TAC	D188Y	NP_751907.1
NM_172168.2	944	Missense Mutation	GAC,TAC	D193Y	NP_751908.1
XM_005255099.4	944	Missense Mutation	GAC,TAC	D193Y	XP_005255156.1
XM_017022927.1	944	Missense Mutation	GAC,TAC	D193Y	XP_016878416.1
XM_017022928.1	944	Missense Mutation	GAC,TAC	D193Y	XP_016878417.1

Gene: SYNGR3
Gene Name: synaptogyrin 3

There are no transcripts associated with this gene.

Gene: TBL3
Gene Name: transducin beta like 3

There are no transcripts associated with this gene.

View Full Product Details