Product Details
- SNP ID
-
rs140778010
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.16:88715839 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TGCCGATGACCAGCACGATGGACAC[A/G]TACAGCCCCATGATGCTGCGGGGGA
- Phenotype
-
MIM: 611184
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
CTU2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs35544968] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CTU2
- Gene Name
- cytosolic thiouridylase subunit 2
- Gene
- MIR4722
- Gene Name
- microRNA 4722
There are no transcripts associated with this gene.
- Gene
- PIEZO1
- Gene Name
- piezo type mechanosensitive ion channel component 1
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_001142864.3 |
7588 |
Silent Mutation |
TAC,TAT |
Y2444Y |
NP_001136336.2 |
- Gene
- RNF166
- Gene Name
- ring finger protein 166
There are no transcripts associated with this gene.
View Full Product Details