Product Details

SNP ID: rs141643937
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:31085651 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AATTACTTTGCATTCAATTTGCATG[C/T]CAGTCACTTAATGCCGGAATTCTGA
Phenotype: MIM: 610561 MIM: 608547
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: PRSS53 PubMed Links

Gene Details

Gene: PRSS53
Gene Name: protease, serine 53

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039503.2		Intron			NP_001034592.1
XM_011545816.1		Intron			XP_011544118.1
XM_011545817.1		Intron			XP_011544119.1
XM_011545818.2		Intron			XP_011544120.1
XM_011545819.1		Intron			XP_011544121.1
XM_011545820.1		Intron			XP_011544122.1

Gene: VKORC1
Gene Name: vitamin K epoxide reductase complex subunit 1

There are no transcripts associated with this gene.

Gene: ZNF646
Gene Name: zinc finger protein 646

There are no transcripts associated with this gene.

View Full Product Details