Product Details

SNP ID

rs142106374

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.16:1510979 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TCATCTGCCTCTTCCACCACCTCCT[C/T]GTCCAGCTCCCTGGCGTCCTCCATG

Phenotype

MIM: 614620 MIM: 611140

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

IFT140 PubMed Links

Additional Information

For this assay, SNP(s) [rs1053730] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

IFT140

Gene Name

intraflagellar transport 140

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014714.3	3436	Missense Mutation	AAG,GAG	K1452E	NP_055529.2
XM_005255725.4	3436	Intron			XP_005255782.1
XM_005255726.3	3436	Intron			XP_005255783.1
XM_006720990.3	3436	Missense Mutation	AAG,GAG	K1452E	XP_006721053.1
XM_006720991.3	3436	Missense Mutation	AAG,GAG	K1452E	XP_006721054.1
XM_006720992.3	3436	Missense Mutation	AAG,GAG	K663E	XP_006721055.1
XM_011522766.2	3436	Missense Mutation	AAG,GAG	K1370E	XP_011521068.1
XM_011522767.2	3436	Missense Mutation	AAG,GAG	K1127E	XP_011521069.1
XM_011522769.2	3436	Intron			XP_011521071.1
XM_011522771.2	3436	Intron			XP_011521073.1
XM_011522772.2	3436	Intron			XP_011521074.1
XM_017023910.1	3436	Missense Mutation	AAG,GAG	K1452E	XP_016879399.1
XM_017023911.1	3436	Missense Mutation	AAG,GAG	K847E	XP_016879400.1

Gene

TELO2

Gene Name

telomere maintenance 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016111.3	3436	Intron			NP_057195.2
XM_011522773.2	3436	Intron			XP_011521075.1
XM_011522774.2	3436	Intron			XP_011521076.1
XM_011522775.2	3436	Intron			XP_011521077.1
XM_011522776.2	3436	Intron			XP_011521078.1
XM_011522777.2	3436	Intron			XP_011521079.1
XM_011522778.2	3436	Intron			XP_011521080.1
XM_017023914.1	3436	Intron			XP_016879403.1

View Full Product Details