Product Details

SNP ID: rs143319475
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:30372099 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTTCTCCTCACCTTTCCCATCTCCC[A/G]TTTGACCCAAGCTTCCTGAGCTCTC
Phenotype: MIM: 612897 MIM: 613620
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC107983970 PubMed Links

Gene Details

Gene: LOC107983970
Gene Name: uncharacterized LOC107983970

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_011546022.2		Intron			XP_011544324.1

Gene: MYLPF
Gene Name: myosin light chain, phosphorylatable, fast skeletal muscle

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001324458.1		Intron			NP_001311387.1
NM_001324459.1		Intron			NP_001311388.1
NM_013292.4		Intron			NP_037424.2

Gene: SEPT1
Gene Name: septin 1

There are no transcripts associated with this gene.

Gene: TBC1D10B
Gene Name: TBC1 domain family member 10B

There are no transcripts associated with this gene.

Gene: ZNF48
Gene Name: zinc finger protein 48

There are no transcripts associated with this gene.

View Full Product Details