Product Details

SNP ID: rs143374039
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:67155245 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCCCCCGAGCCGCACTTCAGATTT[A/C]GCAGCGCATCCTCCAGCTCAGCCAG
Phenotype: MIM: 609077 MIM: 602438 MIM: 603500
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: B3GNT9 PubMed Links

Gene Details

Gene: B3GNT9
Gene Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9

There are no transcripts associated with this gene.

Gene: C16orf70
Gene Name: chromosome 16 open reading frame 70

There are no transcripts associated with this gene.

Gene: FBXL8
Gene Name: F-box and leucine rich repeat protein 8

There are no transcripts associated with this gene.

Gene: HSF4
Gene Name: heat shock transcription factor 4

There are no transcripts associated with this gene.

Gene: TRADD
Gene Name: TNFRSF1A associated via death domain

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001323552.1	572	Missense Mutation	CGA,CTA	R160L	NP_001310481.1
NM_003789.3	572	Missense Mutation	CGA,CTA	R160L	NP_003780.1
XM_005256213.3	572	Missense Mutation	CGA,CTA	R100L	XP_005256270.1
XM_017023815.1	572	Missense Mutation	CGA,CTA	R160L	XP_016879304.1

View Full Product Details