Product Details

SNP ID: rs143848598
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:67884979 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTGAGGCCGTTGCTGTTGCTGCCC[C/T]TCGGTGAGTGCGGGCATCCGGGGCC
Phenotype: MIM: 606030 MIM: 177015
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: EDC4 PubMed Links

Gene Details

Gene: EDC4
Gene Name: enhancer of mRNA decapping 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014329.4	102	Intron			NP_055144.3

Gene: NRN1L
Gene Name: neuritin 1 like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_198443.1	102	Missense Mutation	CTC,TTC	L26F	NP_940845.1

Gene: PSKH1
Gene Name: protein serine kinase H1

There are no transcripts associated with this gene.

View Full Product Details