Product Details

SNP ID: rs144298537
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:30764317 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAGTTCTCCAAGGCAGCTGTGTCTC[A/G]TGTGGTAGAGGCCTCAGACCGCCTA
Phenotype: MIM: 172471 MIM: 607700
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CCDC189 PubMed Links

Gene Details

Gene: CCDC189
Gene Name: coiled-coil domain containing 189

There are no transcripts associated with this gene.

Gene: PHKG2
Gene Name: phosphorylase kinase catalytic subunit gamma 2

There are no transcripts associated with this gene.

Gene: RNF40
Gene Name: ring finger protein 40

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001207033.1	742	Missense Mutation	CAT,CGT	H194R	NP_001193962.1
NM_001207034.1	742	Missense Mutation	CAT,CGT	H194R	NP_001193963.1
NM_001286572.2	742	Missense Mutation	CAT,CGT	H194R	NP_001273501.1
NM_014771.3	742	Missense Mutation	CAT,CGT	H194R	NP_055586.1
XM_011545997.1	742	Missense Mutation	CAT,CGT	H194R	XP_011544299.1

View Full Product Details