Product Details

SNP ID: rs144724709
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:4797771 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGACGGTGAAGTAGACCAGGGCGTC[A/G]TTGAGCCAGGGGATCACGCACTCCA
Phenotype: MIM: 610660 MIM: 614574 MIM: 611562
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: GLYR1 PubMed Links

Gene Details

Gene: GLYR1
Gene Name: glyoxylate reductase 1 homolog

There are no transcripts associated with this gene.

Gene: ROGDI
Gene Name: rogdi homolog

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024589.2	1144	Silent Mutation	AAC,AAT	N255N	NP_078865.1
XM_006720947.3	1144	Silent Mutation	AAC,AAT	N262N	XP_006721010.1
XM_006720948.3	1144	Silent Mutation	AAC,AAT	N172N	XP_006721011.1

Gene: SEPT12
Gene Name: septin 12

There are no transcripts associated with this gene.

Gene: SMIM22
Gene Name: small integral membrane protein 22

There are no transcripts associated with this gene.

View Full Product Details