Product Details

SNP ID: rs144739067
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:30524667 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCGTGGAGGAGCGGCAGAAGCCCTT[A/G]CCGCACACGGCGCACCTGTAGGGCC
Phenotype: MIM: 153370
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ITGAL PubMed Links

Gene Details

Gene: ITGAL
Gene Name: integrin subunit alpha L

There are no transcripts associated with this gene.

Gene: ZNF747
Gene Name: zinc finger protein 747

There are no transcripts associated with this gene.

Gene: ZNF768
Gene Name: zinc finger protein 768

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024671.3	1474	Silent Mutation	GGC,GGT	G491G	NP_078947.3
XM_017023665.1	1474	Silent Mutation	GGC,GGT	G515G	XP_016879154.1
XM_017023666.1	1474	Silent Mutation	GGC,GGT	G460G	XP_016879155.1

View Full Product Details