Product Details

SNP ID: rs145637964
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:590329 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCAGTCCGGTGAAGAGCTACGACT[A/T]CCTGCTCAAGTTCCTGCTGGTGGGC
Phenotype: MIM: 605754
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: LOC101929280 PubMed Links

Gene Details

Gene: LOC101929280
Gene Name: uncharacterized LOC101929280

There are no transcripts associated with this gene.

Gene: PIGQ
Gene Name: phosphatidylinositol glycan anchor biosynthesis class Q

There are no transcripts associated with this gene.

Gene: RAB40C
Gene Name: RAB40C, member RAS oncogene family

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001172663.1	112	Missense Mutation	TAC,TTC	Y13F	NP_001166134.1
NM_001172664.1	112	Missense Mutation	TAC,TTC	Y13F	NP_001166135.1
NM_001172665.1	112	Missense Mutation	TAC,TTC	Y13F	NP_001166136.1
NM_001172666.1	112	Missense Mutation	TAC,TTC	Y13F	NP_001166137.1
NM_021168.4	112	Missense Mutation	TAC,TTC	Y13F	NP_066991.3

View Full Product Details