Product Details
- SNP ID
-
rs145663132
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.16:11281010 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TGTGCAATTAGTGTCTTCTACATCG[C/T]GGTCTGTACCTGGGGCGGCAGCACC
- Phenotype
-
MIM: 182880
MIM: 182890
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
PRM1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs737008] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- PRM1
- Gene Name
- protamine 1
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_002761.2 |
235 |
Silent Mutation |
CCA,CCG |
P46P |
NP_002752.1 |
- Gene
- PRM2
- Gene Name
- protamine 2
There are no transcripts associated with this gene.
- Gene
- PRM3
- Gene Name
- protamine 3
There are no transcripts associated with this gene.
View Full Product Details