Product Details

SNP ID: rs148592234
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:29996703 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CATCCCCGAGTAGGGCCACAAGTGC[A/C]TGGGCTCTTTCAAGTATCCGATGGG
Phenotype: MIM: 604567 MIM: 603365 MIM: 613199
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: DOC2A PubMed Links

Gene Details

Gene: DOC2A
Gene Name: double C2 domain alpha

There are no transcripts associated with this gene.

Gene: HIRIP3
Gene Name: HIRA interacting protein 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001197323.1		Intron			NP_001184252.1
NM_003609.4		Intron			NP_003600.2

Gene: INO80E
Gene Name: INO80 complex subunit E

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304562.1		Intron			NP_001291491.1
NM_001304563.1		Intron			NP_001291492.1
NM_173618.2		Intron			NP_775889.1
XM_011545809.2		Intron			XP_011544111.1
XM_011545811.2		Intron			XP_011544113.1
XM_011545812.2		Intron			XP_011544114.1
XM_017023169.1		Intron			XP_016878658.1

Gene: TAOK2
Gene Name: TAO kinase 2

There are no transcripts associated with this gene.

View Full Product Details