Product Details

SNP ID: rs150963331
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:2152847 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGGCTGACCGAGATCCACGAGTAC[A/G]CCCAGCACGACGTGGCGCTCATGCT
Phenotype: MIM: 605455 MIM: 606692
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: RAB26 PubMed Links

Gene Details

Gene: RAB26
Gene Name: RAB26, member RAS oncogene family

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001308053.1	669	Missense Mutation	ACC,GCC	T100A	NP_001294982.1
NM_014353.4	669	Missense Mutation	ACC,GCC	T166A	NP_055168.2
XM_011522448.1	669	Missense Mutation	ACC,GCC	T166A	XP_011520750.1
XM_011522450.2	669	Missense Mutation	ACC,GCC	T50A	XP_011520752.1

Gene: SNHG19
Gene Name: small nucleolar RNA host gene 19

There are no transcripts associated with this gene.

Gene: SNORD60
Gene Name: small nucleolar RNA, C/D box 60

There are no transcripts associated with this gene.

Gene: TRAF7
Gene Name: TNF receptor associated factor 7

There are no transcripts associated with this gene.

View Full Product Details