Product Details

SNP ID
rs137911830
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.17:44190586 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
AGACCCAGCCCGCACACTGCGTTCT[C/T]TGAACATTACCGACAACTGTGTGAT
Phenotype
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
ASB16-AS1 PubMed Links
Additional Information
For this assay, SNP(s) [rs9895154] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
ASB16-AS1
Gene Name
ASB16 antisense RNA 1
There are no transcripts associated with this gene.

Gene
ATXN7L3
Gene Name
ataxin 7 like 3
There are no transcripts associated with this gene.

Gene
LOC101926967
Gene Name
uncharacterized LOC101926967
There are no transcripts associated with this gene.

Gene
TMUB2
Gene Name
transmembrane and ubiquitin like domain containing 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001076674.1 1278 Silent Mutation CTG,TTG L230L NP_001070142.1
NM_024107.2 1278 Silent Mutation CTG,TTG L210L NP_077012.2
NM_177441.2 1278 Silent Mutation CTG,TTG L210L NP_803190.2
XM_011525198.2 1278 Silent Mutation CTG,TTG L230L XP_011523500.1
XM_011525200.2 1278 Silent Mutation CTG,TTG L283L XP_011523502.1
XM_011525201.2 1278 Silent Mutation CTG,TTG L230L XP_011523503.1
XM_011525203.2 1278 Silent Mutation CTG,TTG L221L XP_011523505.1
XM_011525204.2 1278 Silent Mutation CTG,TTG L221L XP_011523506.1
XM_011525205.2 1278 Silent Mutation CTG,TTG L210L XP_011523507.1
XM_011525206.2 1278 Silent Mutation CTG,TTG L210L XP_011523508.1
XM_011525207.2 1278 Silent Mutation CTG,TTG L210L XP_011523509.1
XM_011525208.2 1278 Silent Mutation CTG,TTG L210L XP_011523510.1
XM_011525209.2 1278 Silent Mutation CTG,TTG L210L XP_011523511.1
XM_011525210.2 1278 Silent Mutation CTG,TTG L173L XP_011523512.1
XM_011525211.2 1278 UTR 3 XP_011523513.1
XM_017025047.1 1278 Silent Mutation CTG,TTG L221L XP_016880536.1
XM_017025048.1 1278 Silent Mutation CTG,TTG L210L XP_016880537.1
XM_017025049.1 1278 Silent Mutation CTG,TTG L210L XP_016880538.1
XM_017025050.1 1278 Silent Mutation CTG,TTG L210L XP_016880539.1
XM_017025051.1 1278 Silent Mutation CTG,TTG L210L XP_016880540.1
XM_017025052.1 1278 Silent Mutation CTG,TTG L184L XP_016880541.1
XM_017025053.1 1278 Silent Mutation CTG,TTG L184L XP_016880542.1
XM_017025054.1 1278 Silent Mutation CTG,TTG L173L XP_016880543.1
XM_017025055.1 1278 Silent Mutation CTG,TTG L173L XP_016880544.1
XM_017025056.1 1278 UTR 3 XP_016880545.1

View Full Product Details