Product Details

SNP ID: rs137928765
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:81665297 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTCCTCCAGGGCAGCCAGGGCCCG[C/T]TCCCCACCGTCCTGGAAGTGCTGCA
Phenotype: MIM: 614271 MIM: 180073
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CCDC137 PubMed Links

Gene Details

Gene: CCDC137
Gene Name: coiled-coil domain containing 137

There are no transcripts associated with this gene.

Gene: OXLD1
Gene Name: oxidoreductase like domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039842.2	408	Silent Mutation			NP_001034931.1
NM_001304994.1	408	Silent Mutation			NP_001291923.1
NM_001304995.1	408	UTR 3			NP_001291924.1
NM_001304999.1	408	UTR 3			NP_001291928.1

Gene: PDE6G
Gene Name: phosphodiesterase 6G

There are no transcripts associated with this gene.

View Full Product Details