Product Details

SNP ID: rs140160816
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:28747228 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCATTTCAGTGAAGGAGTCTTCAA[A/G]TGCCCTGAGGACCAGCTTCCTCTGG
Phenotype: MIM: 609799 MIM: 602464
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FAM222B PubMed Links

Gene Details

Gene: FAM222B
Gene Name: family with sequence similarity 222 member B

There are no transcripts associated with this gene.

Gene: NEK8
Gene Name: NIMA related kinase 8

There are no transcripts associated with this gene.

Gene: TRAF4
Gene Name: TNF receptor associated factor 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004295.3	269	Silent Mutation	AAA,AAG	K53K	NP_004286.2
XM_011525504.2	269	Silent Mutation	AAA,AAG	K53K	XP_011523806.1
XM_011525505.2	269	Silent Mutation	AAA,AAG	K37K	XP_011523807.1
XM_011525506.2	269	Silent Mutation	AAA,AAG	K37K	XP_011523808.1
XM_011525507.2	269	UTR 5			XP_011523809.1
XM_011525508.2	269	UTR 5			XP_011523810.1

View Full Product Details