Product Details

SNP ID: rs140831209
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7926097 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCTTGAGGATGTTCCCTAGGGTTCT[C/T]TCAGCCCTAAAAGAAACATAAGGCA
Phenotype: MIM: 611425 MIM: 604111 MIM: 610969
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CNTROB PubMed Links

Gene Details

Gene: CNTROB
Gene Name: centrobin, centriole duplication and spindle assembly protein

There are no transcripts associated with this gene.

Gene: KCNAB3
Gene Name: potassium voltage-gated channel subfamily A regulatory beta subunit 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004732.3	358	Silent Mutation	GAA,GAG	E137E	NP_004723.2
XM_011524068.1	358	Silent Mutation	GAA,GAG	E88E	XP_011522370.1
XM_017025304.1	358	Silent Mutation	GAA,GAG	E88E	XP_016880793.1
XM_017025305.1	358	Silent Mutation	GAA,GAG	E88E	XP_016880794.1
XM_017025306.1	358	Silent Mutation	GAA,GAG	E88E	XP_016880795.1

Gene: TRAPPC1
Gene Name: trafficking protein particle complex 1

There are no transcripts associated with this gene.

View Full Product Details