Product Details

SNP ID: rs141193307
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:58541827 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAAATCCCAGCATTTATCTCCTAAA[C/T]GACCCAGCTCTGTAGATACATAGAT
Phenotype: MIM: 603696
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C17orf47 PubMed Links

Gene Details

Gene: C17orf47
Gene Name: chromosome 17 open reading frame 47

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001038704.2	1802	Silent Mutation	TCA,TCG	S567S	NP_001033793.2
XM_011524637.2	1802	Missense Mutation	CAT,CGT	H539R	XP_011522939.1
XM_017024498.1	1802	Intron			XP_016879987.1

Gene: SEPT4
Gene Name: septin 4

There are no transcripts associated with this gene.

Gene: SEPT4-AS1
Gene Name: SEPT4 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details