Product Details

SNP ID: rs141547861
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:42669996 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCGCCAGGGCCAGGTAGGCGGCCAT[C/G]GCCTCAGCTCGGCCCATGCCCCGTA
Phenotype: MIM: 600240 MIM: 602346 MIM: 605785
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CCR10 PubMed Links

Gene Details

Gene: CCR10
Gene Name: C-C motif chemokine receptor 10

There are no transcripts associated with this gene.

Gene: CNTNAP1
Gene Name: contactin associated protein 1

There are no transcripts associated with this gene.

Gene: PLEKHH3
Gene Name: pleckstrin homology, MyTH4 and FERM domain containing H3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024927.4	2238	Silent Mutation	GCC,GCG	A645A	NP_079203.3
XM_017025113.1	2238	Silent Mutation	GCC,GCG	A734A	XP_016880602.1
XM_017025114.1	2238	Silent Mutation	GCC,GCG	A731A	XP_016880603.1
XM_017025115.1	2238	Silent Mutation	GCC,GCG	A690A	XP_016880604.1
XM_017025116.1	2238	Silent Mutation	GCC,GCG	A689A	XP_016880605.1
XM_017025117.1	2238	Silent Mutation	GCC,GCG	A674A	XP_016880606.1
XM_017025118.1	2238	Silent Mutation	GCC,GCG	A642A	XP_016880607.1

Gene: TUBG2
Gene Name: tubulin gamma 2

There are no transcripts associated with this gene.

View Full Product Details