Product Details

SNP ID: rs142513726
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:28547637 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCTCCCGCAGCTCAGTCTCTAGAC[A/G]CCCCCACTTCCCCACTCCCAGAAGA
Phenotype: MIM: 600838 MIM: 610271 MIM: 604011
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FOXN1 PubMed Links

Gene Details

Gene: FOXN1
Gene Name: forkhead box N1

There are no transcripts associated with this gene.

Gene: PIGS
Gene Name: phosphatidylinositol glycan anchor biosynthesis class S

There are no transcripts associated with this gene.

Gene: UNC119
Gene Name: unc-119 lipid binding chaperone

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005148.3	721	Intron			NP_005139.1
NM_054035.2	721	Missense Mutation	GCG,GTG	A217V	NP_473376.1
XM_011525459.2	721	Intron			XP_011523761.1
XM_017025289.1	721	Intron			XP_016880778.1

View Full Product Details