Product Details

SNP ID: rs142549864
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:28547687 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACCCTGCCCGCGCACTCAGCTCCTC[A/G]GAGAGAGGGGGGAAGTCGTAAATGT
Phenotype: MIM: 600838 MIM: 610271 MIM: 604011
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FOXN1 PubMed Links

Gene Details

Gene: FOXN1
Gene Name: forkhead box N1

There are no transcripts associated with this gene.

Gene: PIGS
Gene Name: phosphatidylinositol glycan anchor biosynthesis class S

There are no transcripts associated with this gene.

Gene: UNC119
Gene Name: unc-119 lipid binding chaperone

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005148.3	671	Silent Mutation	TCC,TCT	S200S	NP_005139.1
NM_054035.2	671	Silent Mutation	TCC,TCT	S200S	NP_473376.1
XM_011525459.2	671	Intron			XP_011523761.1
XM_017025289.1	671	Silent Mutation	TCC,TCT	S105S	XP_016880778.1

View Full Product Details