Product Details

SNP ID: rs146415100
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7579973 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGACAACCACCACAGGCACCACCAG[C/T]CACGGACCCACGACTGCCACTCACA
Phenotype: MIM: 153634 MIM: 602641 MIM: 604041 MIM: 612844 MIM: 601297
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CD68 PubMed Links

Gene Details

Gene: CD68
Gene Name: CD68 molecule

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040059.1	404	Silent Mutation	AGC,AGT	S44S	NP_001035148.1
NM_001251.2	404	Silent Mutation	AGC,AGT	S71S	NP_001242.2

Gene: EIF4A1
Gene Name: eukaryotic translation initiation factor 4A1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204510.1	404	Intron			NP_001191439.1
NM_001416.3	404	Intron			NP_001407.1

Gene: LOC100996842
Gene Name: uncharacterized LOC100996842

There are no transcripts associated with this gene.

Gene: MPDU1
Gene Name: mannose-P-dolichol utilization defect 1

There are no transcripts associated with this gene.

Gene: SENP3
Gene Name: SUMO1/sentrin/SMT3 specific peptidase 3

There are no transcripts associated with this gene.

Gene: SENP3-EIF4A1
Gene Name: SENP3-EIF4A1 readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: SNORA48
Gene Name: small nucleolar RNA, H/ACA box 48

There are no transcripts associated with this gene.

Gene: SNORA67
Gene Name: small nucleolar RNA, H/ACA box 67

There are no transcripts associated with this gene.

Gene: SNORD10
Gene Name: small nucleolar RNA, C/D box 10

There are no transcripts associated with this gene.

Gene: SOX15
Gene Name: SRY-box 15

There are no transcripts associated with this gene.

View Full Product Details