Product Details

SNP ID: rs147051753
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:42670581 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACGCCGGAGAGCCTCACCTGCTCAA[A/G]GAGGAAAGGCAGTTCGTGACCGTCT
Phenotype: MIM: 600240 MIM: 602346 MIM: 605785
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CCR10 PubMed Links

Gene Details

Gene: CCR10
Gene Name: C-C motif chemokine receptor 10

There are no transcripts associated with this gene.

Gene: CNTNAP1
Gene Name: contactin associated protein 1

There are no transcripts associated with this gene.

Gene: PLEKHH3
Gene Name: pleckstrin homology, MyTH4 and FERM domain containing H3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024927.4	1849	Missense Mutation	CTT,TTT	L516F	NP_079203.3
XM_017025113.1	1849	Missense Mutation	CTT,TTT	L605F	XP_016880602.1
XM_017025114.1	1849	Missense Mutation	CTT,TTT	L602F	XP_016880603.1
XM_017025115.1	1849	Missense Mutation	CTT,TTT	L561F	XP_016880604.1
XM_017025116.1	1849	Missense Mutation	CTT,TTT	L560F	XP_016880605.1
XM_017025117.1	1849	Missense Mutation	CTT,TTT	L545F	XP_016880606.1
XM_017025118.1	1849	Missense Mutation	CTT,TTT	L513F	XP_016880607.1

Gene: TUBG2
Gene Name: tubulin gamma 2

There are no transcripts associated with this gene.

View Full Product Details