Product Details

SNP ID: rs149102251
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:48597813 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGCTCTTCTGTCTCGCCGAACACG[C/T]TCTTGTCCTGCGCGCAGTCCGACTT
Phenotype: MIM: 142966 MIM: 142960 MIM: 142961 MIM: 142962
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: HOXB-AS3 PubMed Links

Gene Details

Gene: HOXB-AS3
Gene Name: HOXB cluster antisense RNA 3

There are no transcripts associated with this gene.

Gene: HOXB3
Gene Name: homeobox B3

There are no transcripts associated with this gene.

Gene: HOXB5
Gene Name: homeobox B5

There are no transcripts associated with this gene.

Gene: HOXB6
Gene Name: homeobox B6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018952.4	905	Missense Mutation			NP_061825.2
XM_005257283.3	905	Missense Mutation			XP_005257340.1
XM_005257284.3	905	Missense Mutation			XP_005257341.1
XM_011524727.2	905	Missense Mutation			XP_011523029.1

Gene: HOXB7
Gene Name: homeobox B7

There are no transcripts associated with this gene.

View Full Product Details