Product Details

SNP ID: rs151252462
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:35735302 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGTCTGCGTCCCCACCACCGCCCGC[C/T]GCCTTTACCTGCCTGCTGTCGTCAT
Phenotype: MIM: 601025 MIM: 611398 MIM: 612128
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AP2B1 PubMed Links

Gene Details

Gene: AP2B1
Gene Name: adaptor related protein complex 2 beta 1 subunit

There are no transcripts associated with this gene.

Gene: GAS2L2
Gene Name: growth arrest specific 2 like 2

There are no transcripts associated with this gene.

Gene: RASL10B
Gene Name: RAS like family 10 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_033315.3	484	Missense Mutation	CGC,TGC	R40C	NP_201572.1
XM_017025300.1	484	Missense Mutation	CGC,TGC	R99C	XP_016880789.1
XM_017025301.1	484	Missense Mutation	CGC,TGC	R40C	XP_016880790.1

View Full Product Details