Product Details

SNP ID

rs145453378

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.18:50270661 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TGAGGAATCCTATGCAGCACCTGGG[A/G]TCTGCAGGAAACCCAGTTTCTGTAT

Phenotype

MIM: 614759 MIM: 156535

Polymorphism

A/G, Transition substitution

Allele Nomenclature

Literature Links

CFAP53 PubMed Links

Gene Details

Gene

CFAP53

Gene Name

cilia and flagella associated protein 53

There are no transcripts associated with this gene.

Gene

MBD1

Gene Name

methyl-CpG binding domain protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204136.1	2779	Intron			NP_001191065.1
NM_001204137.1	2779	Intron			NP_001191066.1
NM_001204138.1	2779	Intron			NP_001191067.1
NM_001204139.1	2779	Intron			NP_001191068.1
NM_001204140.1	2779	Intron			NP_001191069.1
NM_001204141.1	2779	Intron			NP_001191070.1
NM_001204142.1	2779	Intron			NP_001191071.1
NM_001204143.1	2779	Intron			NP_001191072.1
NM_001204151.2	2779	Intron			NP_001191080.1
NM_001323942.1	2779	Intron			NP_001310871.1
NM_001323947.1	2779	Intron			NP_001310876.1
NM_001323949.1	2779	Intron			NP_001310878.1
NM_001323950.1	2779	Intron			NP_001310879.1
NM_001323951.1	2779	Intron			NP_001310880.1
NM_001323952.1	2779	Intron			NP_001310881.1
NM_001323953.1	2779	Intron			NP_001310882.1
NM_001323954.1	2779	Intron			NP_001310883.1
NM_002384.2	2779	Intron			NP_002375.1
NM_015844.2	2779	Intron			NP_056669.2
NM_015845.3	2779	Intron			NP_056670.2
NM_015846.3	2779	Intron			NP_056671.2
NM_015847.3	2779	Intron			NP_056723.2
XM_005258271.2	2779	UTR 3			XP_005258328.1
XM_006722456.2	2779	Intron			XP_006722519.1
XM_011525991.1	2779	Intron			XP_011524293.1
XM_011525993.2	2779	Intron			XP_011524295.1
XM_011525994.2	2779	Intron			XP_011524296.1
XM_011525998.2	2779	Intron			XP_011524300.1
XM_011525999.1	2779	Intron			XP_011524301.1
XM_011526001.1	2779	Intron			XP_011524303.1
XM_011526002.1	2779	UTR 3			XP_011524304.1
XM_011526003.2	2779	Intron			XP_011524305.1
XM_011526006.1	2779	Intron			XP_011524308.1
XM_011526007.1	2779	UTR 3			XP_011524309.1
XM_017025751.1	2779	Intron			XP_016881240.1
XM_017025752.1	2779	Intron			XP_016881241.1
XM_017025753.1	2779	Intron			XP_016881242.1
XM_017025754.1	2779	Intron			XP_016881243.1
XM_017025755.1	2779	Intron			XP_016881244.1
XM_017025756.1	2779	Intron			XP_016881245.1
XM_017025757.1	2779	UTR 3			XP_016881246.1
XM_017025758.1	2779	Intron			XP_016881247.1
XM_017025759.1	2779	Intron			XP_016881248.1
XM_017025760.1	2779	Intron			XP_016881249.1
XM_017025761.1	2779	Intron			XP_016881250.1
XM_017025762.1	2779	Intron			XP_016881251.1
XM_017025763.1	2779	UTR 3			XP_016881252.1
XM_017025764.1	2779	Intron			XP_016881253.1
XM_017025765.1	2779	Intron			XP_016881254.1
XM_017025766.1	2779	Intron			XP_016881255.1
XM_017025767.1	2779	Intron			XP_016881256.1
XM_017025768.1	2779	Intron			XP_016881257.1
XM_017025769.1	2779	Intron			XP_016881258.1
XM_017025770.1	2779	UTR 3			XP_016881259.1
XM_017025771.1	2779	Intron			XP_016881260.1
XM_017025772.1	2779	Intron			XP_016881261.1
XM_017025773.1	2779	UTR 3			XP_016881262.1
XM_017025774.1	2779	Intron			XP_016881263.1
XM_017025775.1	2779	Intron			XP_016881264.1
XM_017025776.1	2779	UTR 3			XP_016881265.1
XM_017025777.1	2779	Intron			XP_016881266.1

View Full Product Details