Product Details
- SNP ID
-
rs137989431
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:53015354 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TGGGGCGATAGAGGAGGATATAAAA[A/T]AGATCTATGATGAGGTTACGTGGCT
- Phenotype
-
- Polymorphism
- A/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
ERVV-1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs1650925] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ERVV-1
- Gene Name
- endogenous retrovirus group V member 1
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_152473.2 |
|
Intron |
|
|
NP_689686.2 |
- Gene
- LOC107985332
- Gene Name
- uncharacterized LOC107985332
There are no transcripts associated with this gene.
View Full Product Details