Product Details

SNP ID: rs140094235
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:13766049 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCCGCCACCTCCTGGAGCGGGTGG[C/T]CCCCAGCGGTGGCAAGGTGACTGTG
Phenotype: MIM: 615105
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C19orf53 PubMed Links

Gene Details

Gene: C19orf53
Gene Name: chromosome 19 open reading frame 53

There are no transcripts associated with this gene.

Gene: CCDC130
Gene Name: coiled-coil domain containing 130

There are no transcripts associated with this gene.

Gene: MRI1
Gene Name: methylthioribose-1-phosphate isomerase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_011528355.2	564	Intron			XP_011526657.1
XM_011528356.2	564	Missense Mutation	GCC,GTC	A156V	XP_011526658.1
XM_011528357.2	564	Missense Mutation	GCC,GTC	A156V	XP_011526659.1

View Full Product Details