Product Details

SNP ID: rs141888879
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:17227193 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTAGGCCCCACCCAGTGCCCGACT[A/G]TGAGCTGTGAGTGTCCCCCATGTGA
Phenotype: MIM: 132880 MIM: 610675
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: NR2F6 PubMed Links

Gene Details

Gene: NR2F6
Gene Name: nuclear receptor subfamily 2 group F member 6

There are no transcripts associated with this gene.

Gene: OCEL1
Gene Name: occludin/ELL domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024578.2	490	Missense Mutation	TAT,TGT	Y149C	NP_078854.1
XM_005260079.2	490	Missense Mutation	TAT,TGT	Y93C	XP_005260136.1
XM_006722899.3	490	Missense Mutation	TAT,TGT	Y149C	XP_006722962.1
XM_017027306.1	490	Missense Mutation	TAT,TGT	Y93C	XP_016882795.1

Gene: USE1
Gene Name: unconventional SNARE in the ER 1

There are no transcripts associated with this gene.

View Full Product Details