Product Details

SNP ID: rs142553701
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:38394757 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCTTCAGGCTTCGGGCCGACCACG[A/C]CCCCCCAGCGCCGCCGCTCCTCCGC
Phenotype: MIM: 609966 MIM: 609293
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: FAM98C PubMed Links

Gene Details

Gene: FAM98C
Gene Name: family with sequence similarity 98 member C

There are no transcripts associated with this gene.

Gene: GGN
Gene Name: gametogenetin

There are no transcripts associated with this gene.

Gene: SPRED3
Gene Name: sprouty related EVH1 domain containing 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001042522.2	641	Missense Mutation	ACC,CCC	T180P	NP_001035987.1
XM_006723219.3	641	Missense Mutation	ACC,CCC	T180P	XP_006723282.1
XM_011526978.2	641	Missense Mutation	ACC,CCC	T149P	XP_011525280.1

View Full Product Details