Product Details

SNP ID: rs143043518
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:55230171 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCTAACACCAGCTCCCGCTGGGAC[G/T]GAACAGGGAAGGCTGTGCTTTGGAG
Phenotype: MIM: 610875
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: MIR6802 PubMed Links

Gene Details

Gene: MIR6802
Gene Name: microRNA 6802

There are no transcripts associated with this gene.

Gene: MIR6804
Gene Name: microRNA 6804

There are no transcripts associated with this gene.

Gene: PPP6R1
Gene Name: protein phosphatase 6 regulatory subunit 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014931.3	3245	UTR 3			NP_055746.3

Gene: TMEM86B
Gene Name: transmembrane protein 86B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_173804.4	3245	Intron			NP_776165.3
XM_017026554.1	3245	Intron			XP_016882043.1

View Full Product Details