Product Details

SNP ID: rs145099125
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:55174934 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCAGGTTTTTAGCCTCCAGGACGAT[A/G]ACGGTGAGCTTCCCGGCCGTGGGGA
Phenotype: MIM: 614566 MIM: 602510 MIM: 600782
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DNAAF3 PubMed Links

Gene Details

Gene: DNAAF3
Gene Name: dynein axonemal assembly factor 3

There are no transcripts associated with this gene.

Gene: PTPRH
Gene Name: protein tyrosine phosphatase, receptor type H

There are no transcripts associated with this gene.

Gene: SYT5
Gene Name: synaptotagmin 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297774.1	1141	Silent Mutation	GTC,GTT	V254V	NP_001284703.1
NM_003180.2	1141	Silent Mutation	GTC,GTT	V258V	NP_003171.2
XM_006723339.3	1141	Silent Mutation	GTC,GTT	V258V	XP_006723402.1
XM_006723340.3	1141	Silent Mutation	GTC,GTT	V257V	XP_006723403.1
XM_006723341.3	1141	Silent Mutation	GTC,GTT	V255V	XP_006723404.1
XM_017027175.1	1141	Silent Mutation	GTC,GTT	V258V	XP_016882664.1
XM_017027176.1	1141	Silent Mutation	GTC,GTT	V258V	XP_016882665.1

View Full Product Details