Product Details

SNP ID: rs145722764
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:45517949 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACCAGGTGGTCATCAACTGTGCCAT[A/C]GTCCGGGGTGTCAAGTATAACCAGG
Phenotype: MIM: 606580 MIM: 601703
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: OPA3 PubMed Links

Gene Details

Gene: OPA3
Gene Name: optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia)

There are no transcripts associated with this gene.

Gene: VASP
Gene Name: vasodilator-stimulated phosphoprotein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003370.3	528	Silent Mutation	ATA,ATC	I66I	NP_003361.1
XM_005259199.1	528	Silent Mutation	ATA,ATC	I66I	XP_005259256.1
XM_005259200.1	528	Silent Mutation	ATA,ATC	I66I	XP_005259257.1
XM_017027200.1	528	Silent Mutation	ATA,ATC	I66I	XP_016882689.1

View Full Product Details