Product Details

SNP ID

rs146360251

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.19:37739124 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TGAATATTCTGATGTCGAGTAAGAT[C/T]TCTATACAAAGTAAAGGTTTTTTTA

Phenotype

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

ZNF573 PubMed Links

Additional Information

For this assay, SNP(s) [rs11666245] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ZNF573

Gene Name

zinc finger protein 573

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001172689.1	1302	Missense Mutation	AAT,GAT	N368D	NP_001166160.1
NM_001172690.1	1302	Missense Mutation	AAT,GAT	N456D	NP_001166161.1
NM_001172691.1	1302	Missense Mutation	AAT,GAT	N454D	NP_001166162.1
NM_001172692.1	1302	Missense Mutation	AAT,GAT	N368D	NP_001166163.1
NM_152360.3	1302	Missense Mutation	AAT,GAT	N398D	NP_689573.3
XM_011526446.2	1302	Missense Mutation	AAT,GAT	N471D	XP_011524748.1
XM_017026275.1	1302	Missense Mutation	AAT,GAT	N471D	XP_016881764.1
XM_017026276.1	1302	Missense Mutation	AAT,GAT	N471D	XP_016881765.1
XM_017026277.1	1302	Missense Mutation	AAT,GAT	N469D	XP_016881766.1
XM_017026278.1	1302	Missense Mutation	AAT,GAT	N400D	XP_016881767.1
XM_017026279.1	1302	Missense Mutation	AAT,GAT	N400D	XP_016881768.1
XM_017026280.1	1302	Missense Mutation	AAT,GAT	N368D	XP_016881769.1
XM_017026281.1	1302	Missense Mutation	AAT,GAT	N368D	XP_016881770.1

View Full Product Details