Product Details

SNP ID: rs146941866
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:49861456 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGCTATCCCCAACAGTACCTGTAGC[C/T]ATACATGACCATGTCTGACACGGGG
Phenotype: MIM: 610221 MIM: 605610 MIM: 610195
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AKT1S1 PubMed Links

Gene Details

Gene: AKT1S1
Gene Name: AKT1 substrate 1

There are no transcripts associated with this gene.

Gene: MIR4749
Gene Name: microRNA 4749

There are no transcripts associated with this gene.

Gene: PNKP
Gene Name: polynucleotide kinase 3'-phosphatase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_007254.3	1551	Missense Mutation	AGC,GGC	S481G	NP_009185.2

Gene: PTOV1
Gene Name: prostate tumor overexpressed 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001305105.1	1551	Intron			NP_001292034.1
NM_001305108.1	1551	Intron			NP_001292037.1
NM_017432.4	1551	Intron			NP_059128.2
XM_005258998.4	1551	Intron			XP_005259055.1
XM_006723244.3	1551	Intron			XP_006723307.1
XM_011527033.1	1551	Intron			XP_011525335.1
XM_011527034.2	1551	Intron			XP_011525336.1
XM_011527035.1	1551	Intron			XP_011525337.1
XM_017026879.1	1551	Intron			XP_016882368.1
XM_017026880.1	1551	Intron			XP_016882369.1

Gene: PTOV1-AS1
Gene Name: PTOV1 antisense RNA 1

There are no transcripts associated with this gene.

Gene: PTOV1-AS2
Gene Name: PTOV1 antisense RNA 2

There are no transcripts associated with this gene.

View Full Product Details