Product Details

SNP ID: rs148261115
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.19:2039726 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GACAGCTGCAGGCAGCGTGAGGTAG[A/C]TCGGACCAGGACGGGCTGGCCCTGC
Phenotype: MIM: 605069
Polymorphism: A/C, Transversion Substitution
Allele Nomenclature
Literature Links: MKNK2 PubMed Links
Additional Information: For this assay, SNP(s) [rs34475638] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017572.3	1530	Intron			NP_060042.2
NM_199054.2	1530	Missense Mutation	GCT,TCT	A429S	NP_951009.1