Product Details

SNP ID: rs148304841
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:18442701 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AATTTATTGGAGAATGAAAAAAGTC[A/G]GCATTCACCTGTTTAGTGTACAAAA
Phenotype: MIM: 600284 MIM: 611670 MIM: 607391
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ELL PubMed Links

Gene Details

Gene: ELL
Gene Name: elongation factor for RNA polymerase II

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006532.3	3165	UTR 3			NP_006523.1
XM_011528330.2	3165	Intron			XP_011526632.2
XM_017027335.1	3165	UTR 3			XP_016882824.1
XM_017027336.1	3165	UTR 3			XP_016882825.1
XM_017027337.1	3165	UTR 3			XP_016882826.1

Gene: ISYNA1
Gene Name: inositol-3-phosphate synthase 1

There are no transcripts associated with this gene.

Gene: SSBP4
Gene Name: single stranded DNA binding protein 4

There are no transcripts associated with this gene.

View Full Product Details