Product Details

SNP ID: rs149294692
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:55354427 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGTCTCACCCAGGAAGTTCTGGTAG[A/C]AGTTACGGATCTGGTTCTGGCTGGG
Phenotype: MIM: 147681 MIM: 613198
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: COX6B2 PubMed Links

Gene Details

Gene: COX6B2
Gene Name: cytochrome c oxidase subunit 6B2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_144613.4	278	Missense Mutation	TGC,TTC	C32F	NP_653214.2

Gene: FAM71E2
Gene Name: family with sequence similarity 71 member E2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145402.1	278	Intron			NP_001138874.1

Gene: IL11
Gene Name: interleukin 11

There are no transcripts associated with this gene.

Gene: KMT5C
Gene Name: lysine methyltransferase 5C

There are no transcripts associated with this gene.

View Full Product Details